version
PlantPromoterDB promoter information of AT3G06770.3

Summary of Gene (AT3G06770.3)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G06770  TAIR      NCBI 
Gene model AT3G06770.3  
Description glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G49215.1); Has 1737 Blast hits to 1735 proteins in 255 species: Archae - 2; Bacteria - 483; Metazoa - 5; Fungi - 453; Plants - 700; Viruses - 2; Other Eukaryotes - 92 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 2146566-2145367)

Genome position     
from initiation codon
AT3G06790.1         
AT3G06790.2         
TSS from cDNA
TSS information
AT3G06770.3                      5'->3' (-)
Promoter sequence











 
AT3G06810.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G06770.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-2137334-718
TSS peakG5-2137122-506

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-2137129-513
TSS cloneTclone-2136977-361
TSS cloneGclone-2136962-346

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTCTTCTTCTTCTCTCTCTCTCTCTCTCT-21371232137156-507-540
Y PatchTCCTTCTCCTTCT-21371602137172-544-556
Y PatchCTTTCTTCT-21373032137311-687-695
Y PatchTCTTCTTCCTTC-21373212137332-705-716
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCATTAA-21375232137530-907-914
 AtREG396CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+2146486AT3G06810.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-2145776AT3G06790.1, AT3G06790.2
TSS clone peakCclone-2145749AT3G06790.1, AT3G06790.2
TSS cloneAclone+2146336AT3G06810.1
TSS cloneTclone+2146462AT3G06810.1
TSS cloneTclone+2146480AT3G06810.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCAAAGGCCCACTAAGCCCATATA-21458082145830AT3G06790.1, AT3G06790.2
 AtREG656CAAAGGCC                PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC               PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482   AGGCCCAC             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG532     GCCCACTA           PPDB MotifGCCCA  PLACE Motif 
 AtREG634          CTAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG426           TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378            AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477             AGCCCATA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432              GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620               CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGAATAGCCCATCT-21458442145855AT3G06790.1, AT3G06790.2
 AtREG584AATAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG581  TAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG572    GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGGGCTTTTT+21462202146227AT3G06810.1
 AtREG589GGCTTTTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.