PlantPromoterDB promoter information of AT3G06778.1

Summary of Gene (AT3G06778.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G06778  TAIR      NCBI 
Gene model AT3G06778.1  
Description heat shock protein binding / unfolded protein binding; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G49060.1); Has 13003 Blast hits to 13003 proteins in 1807 species: Archae - 91; Bacteria - 4518; Metazoa - 2691; Fungi - 972; Plants - 1000; Viruses - 10; Other Eukaryotes - 3721 (source: NCBI BLink).  


Focused view (chromosome 3: 2133837-2132638)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT3G06778.1                      5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT3G06778.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakAclone-2141523-86
TSS clone peakAclone-2141522-85

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
TSS peakG4+2132780AT3G06760.1, AT3G06760.2
TSS peakA4+2132808AT3G06760.1, AT3G06760.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS cloneCclone+2132837AT3G06760.1, AT3G06760.2
TSS cloneCclone+2132840AT3G06760.1, AT3G06760.2
TSS cloneTclone+2132857AT3G06760.1, AT3G06760.2
TSS cloneTclone+2132895AT3G06760.1, AT3G06760.2

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTTCC+21328272132837AT3G06760.1, AT3G06760.2
Y PatchTTTCTCTCTCTCTC+21328432132856AT3G06760.1, AT3G06760.2

REG information

TypeSequenceAnnotationGenome positionGene model
REGCACGTGTGA+21326312132639AT3G06760.1, AT3G06760.2
REGCCAAACCGCGTGAAACGAC+21326832132701AT3G06760.1, AT3G06760.2
 AtREG550CCAAACCG            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG441   AACCGCGT        Drought PPDB Motif  PLACE Motif 
 AtREG502     CCGCGTGA      Drought PPDB Motif  PLACE Motif 
 AtREG631      CGCGTGAA     Drought PPDB Motif  PLACE Motif 
 AtREG576           GAAACGAC PPDB Motif  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.