PlantPromoterDB promoter information of AT3G07010

Summary of Gene (AT3G07010)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G07010 TAIR NCBI
Gene model	AT3G07010
Description	pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT5G48900.1); Has 902 Blast hits to 897 proteins in 157 species: Archae - 0; Bacteria - 370; Metazoa - 0; Fungi - 126; Plants - 399; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 2217306-2216107)

`Genome position from initiation codon` `AT3G07010.1 TSS from cDNA TSS information AT3G07010 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G07010

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 30 - 2216416 -110

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	30	-	2216416	-110

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone - 2216483 -177

TSS clone C clone - 2216418 -112

TSS clone C clone - 2216415 -109

TSS clone T clone - 2216403 -97

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	-	2216483	-177
TSS clone	`C`	clone	-	2216418	-112
TSS clone	`C`	clone	-	2216415	-109
TSS clone	`T`	clone	-	2216403	-97

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTTTCCT - 2216380 2216387 -74 -81

Y Patch CTCTTCCT - 2216391 2216398 -85 -92

Y Patch CTCTTCTTCTC - 2216405 2216415 -99 -109

Y Patch CTTTCTTCT - 2216417 2216425 -111 -119

Y Patch CTTCTCTCTCCC - 2216431 2216442 -125 -136

Y Patch TCTTCTTCTT - 2216450 2216459 -144 -153

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTTTCCT`	-	2216380	2216387	-74	-81
Y Patch	`CTCTTCCT`	-	2216391	2216398	-85	-92
Y Patch	`CTCTTCTTCTC`	-	2216405	2216415	-99	-109
Y Patch	`CTTTCTTCT`	-	2216417	2216425	-111	-119
Y Patch	`CTTCTCTCTCCC`	-	2216431	2216442	-125	-136
Y Patch	`TCTTCTTCTT`	-	2216450	2216459	-144	-153
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG ATTAGGCCAATAAGATAATGGG - 2216473 2216494 -167 -188

AtREG506 ATTAGGCC               PPDB Motif PLACE Motif

AtREG611       CCAATAAG         PPDB Motif PLACE Motif

AtREG546               ATAATGGG PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`ATTAGGCCAATAAGATAATGGG`		-	2216473	2216494	-167	-188
	AtREG506	`ATTAGGCC`		PPDB Motif		PLACE Motif
	AtREG611	`CCAATAAG`		PPDB Motif		PLACE Motif
	AtREG546	`ATAATGGG`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None