version
PlantPromoterDB promoter information of AT3G07700

Summary of Gene (AT3G07700)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G07700  TAIR      NCBI 
Gene model AT3G07700  
Description ABC1 family protein; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 7549 Blast hits to 7505 proteins in 1104 species: Archae - 67; Bacteria - 2628; Metazoa - 384; Fungi - 314; Plants - 355; Viruses - 14; Other Eukaryotes - 3787 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 2473741-2472542)

Genome position     
from initiation codon
AT3G07740.1         
AT3G07740.2         
AT3G07740.3         
TSS from cDNA
TSS information
AT3G07700                        5'->3' (-)
Promoter sequence

 
AT3G07750.1         
AT3G07750.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G07700

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-2463864-623
TSS peakA8-2463762-521

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-2463846-605
TSS cloneGclone-2463642-401

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTCTCTCTC-24637912463804-550-563
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGACACC-24638272463834-586-593
 AtREG599ACGACACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-2473095AT3G07740.2, AT3G07740.1, AT3G07740.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-2473095AT3G07740.2, AT3G07740.1, AT3G07740.3
TSS clone peakCclone+2473241AT3G07750.1, AT3G07750.2
TSS clone peakTclone+2473242AT3G07750.1, AT3G07750.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTCTCTT+24732362473247AT3G07750.1, AT3G07750.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCGACTTA-24731472473154AT3G07740.1, AT3G07740.2, AT3G07740.3
 AtREG582CCGACTTA PPDB MotifCCGAC  PLACE MotifCCGAC 
REGTAAGGGTA-24731682473175AT3G07740.1, AT3G07740.2, AT3G07740.3
 AtREG570TAAGGGTA PPDB MotifACCCT  PLACE Motif 
REGTTTCCGGT-24732802473287AT3G07740.1, AT3G07740.2, AT3G07740.3
 AtREG644TTTCCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCCTAGA+24729582472965AT3G07750.1, AT3G07750.2
 AtREG658ACCCTAGA PPDB MotifACCCT  PLACE Motif 
REGTAAGTCGG+24731472473154AT3G07750.1, AT3G07750.2
 AtREG582TAAGTCGG PPDB MotifCCGAC  PLACE MotifCCGAC 
REGTACCCTTA+24731682473175AT3G07750.1, AT3G07750.2
 AtREG570TACCCTTA PPDB MotifACCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.