version
PlantPromoterDB promoter information of AT3G07740.2

Summary of Gene (AT3G07740.2)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G07740  TAIR      NCBI 
Gene model AT3G07740.2  
Description encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1  
#
#

Overview

Focused view (chromosome 3: 2477185-2475986)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G07740.2                      5'->3' (-)
Promoter sequence

 
AT3G07760.1         
AT3G07760.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G07740.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-2473095-610

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-2473095-610

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGACTTA-24731472473154-662-669
 AtREG582CCGACTTA PPDB MotifCCGAC  PLACE MotifCCGAC 
REGTAAGGGTA-24731682473175-683-690
 AtREG570TAAGGGTA PPDB MotifACCCT  PLACE Motif 
REGTTTCCGGT-24732802473287-795-802
 AtREG644TTTCCGGT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8+2476483AT3G07760.1, AT3G07760.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+2476405AT3G07760.1, AT3G07760.2
TSS cloneAclone+2476444AT3G07760.1, AT3G07760.2
TSS cloneAclone+2476452AT3G07760.1, AT3G07760.2
TSS cloneCclone+2476484AT3G07760.1, AT3G07760.2
TSS cloneAclone+2476487AT3G07760.1, AT3G07760.2
TSS cloneTclone+2476508AT3G07760.1, AT3G07760.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTTC+24764342476443AT3G07760.1, AT3G07760.2
Y PatchCTCTTCCTCT+24764972476506AT3G07760.1, AT3G07760.2
Y PatchTCTCTCTCCC+24765082476517AT3G07760.1, AT3G07760.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCGCGTG+24763032476310AT3G07760.1, AT3G07760.2
 AtREG486GGCGCGTG PPDB MotifACGCGC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.