PlantPromoterDB promoter information of AT3G09405.1

Summary of Gene (AT3G09405.1)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G09405 TAIR NCBI
Gene model	AT3G09405.1
Description	FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: pectinacetylesterase family protein (TAIR:AT3G09410.1).

#

Overview

Focused view (chromosome 3: 2890316-2889117)

`Genome position from initiation codon` `AT3G09390.1 TSS from cDNA TSS information AT3G09405.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G09405.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 4 - 2897915 -549

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	4	-	2897915	-549

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TTCGGGTCA - 2898013 2898021 -647 -655

AtREG597 TTCGGGTC PPDB Motif GGGACCC PLACE Motif

AtREG617 TCGGGTCA PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TTCGGGTCA`		-	2898013	2898021	-647	-655
	AtREG597	`TTCGGGTC`		PPDB Motif	`GGGACCC`	PLACE Motif
	AtREG617	`TCGGGTCA`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 44 - 2890224 AT3G09390.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	44	-	2890224	AT3G09390.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone C clone - 2890229 AT3G09390.1

TSS clone A clone - 2890228 AT3G09390.1

TSS clone T clone - 2890227 AT3G09390.1

TSS clone T clone - 2890223 AT3G09390.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`C`	clone	-	2890229	AT3G09390.1
TSS clone	`A`	clone	-	2890228	AT3G09390.1
TSS clone	`T`	clone	-	2890227	AT3G09390.1
TSS clone	`T`	clone	-	2890223	AT3G09390.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box CTTATAAATT - 2890256 2890265 AT3G09390.1

Y Patch CTTCCTCT - 2890242 2890249 AT3G09390.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CTTATAAATT`	-	2890256	2890265	AT3G09390.1
Y Patch	`CTTCCTCT`	-	2890242	2890249	AT3G09390.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None