version
PlantPromoterDB promoter information of AT3G10030.2

Summary of Gene (AT3G10030.2)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G10030  TAIR      NCBI 
Gene model AT3G10030.2  
Description aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 3095831-3094632)

Genome position     
from initiation codon
AT3G10030.1         
TSS from cDNA
TSS information
AT3G10030.2                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G10030.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-3094959-128

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-3094948-117
TSS cloneAclone-3094945-114

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCCT-30949103094917-79-86
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGTTCGGTTTGG-30950173095029-186-198
 AtREG655TGGTTCGG      PPDB Motif  PLACE Motif 
 AtREG451 GGTTCGGT     PPDB Motif  PLACE Motif 
 AtREG556  GTTCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568   TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550     CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGAA-30950513095058-220-227
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTTGG-30950673095076-236-245
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550  CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.