PlantPromoterDB promoter information of AT3G10370

Summary of Gene (AT3G10370)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G10370 TAIR NCBI
Gene model	AT3G10370
Description	mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion.

#

Overview

Focused view (chromosome 3: 3215202-3216401)

`Genome position from initiation codon` `AT3G10370.1 TSS from cDNA TSS information AT3G10370 5'->3' (+) Promoter sequence AT3G10360.1 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G10370

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 4 + 3216394 -108

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	4	+	3216394	-108

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone + 3216395 -107

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	+	3216395	-107

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TTTCTTCTTCTTCTT + 3216419 3216433 -83 -69

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TTTCTTCTTCTTCTT`	+	3216419	3216433	-83	-69
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG AGCCCACT + 3216239 3216246 -263 -256

AtREG510 AGCCCACT PPDB Motif GCCCA PLACE Motif TGGGCY

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`AGCCCACT`		+	3216239	3216246	-263	-256
	AtREG510	`AGCCCACT`		PPDB Motif	`GCCCA`	PLACE Motif	`TGGGCY`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 8 - 3215434 AT3G10360.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	8	-	3215434	AT3G10360.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone T clone - 3215472 AT3G10360.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`T`	clone	-	3215472	AT3G10360.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTTTCTCCTTC - 3215393 3215403 AT3G10360.1

Y Patch CTCCCTCTCTC - 3215405 3215415 AT3G10360.1

Y Patch TCTTCCTC - 3215435 3215442 AT3G10360.1

Y Patch CTTTCTCTC - 3215445 3215453 AT3G10360.1

Y Patch CGTCTCTCAT - 3215472 3215481 AT3G10360.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTTTCTCCTTC`	-	3215393	3215403	AT3G10360.1
Y Patch	`CTCCCTCTCTC`	-	3215405	3215415	AT3G10360.1
Y Patch	`TCTTCCTC`	-	3215435	3215442	AT3G10360.1
Y Patch	`CTTTCTCTC`	-	3215445	3215453	AT3G10360.1
Y Patch	`CGTCTCTCAT`	-	3215472	3215481	AT3G10360.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CGATGTCG - 3215630 3215637 AT3G10360.1

AtREG630 CGATGTCG PPDB Motif PLACE Motif