version
PlantPromoterDB promoter information of AT3G11050.1

Summary of Gene (AT3G11050.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G11050  TAIR      NCBI 
Gene model AT3G11050.1  
Description ferritin 2 (ATFER2); FUNCTIONS IN: oxidoreductase activity, ferric iron binding, binding, transition metal ion binding; INVOLVED IN: response to oxidative stress, cellular iron ion homeostasis, response to abscisic acid stimulus, iron ion transport; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Ferritin, N-terminal (InterPro:IPR001519), Ferritin-related (InterPro:IPR012347), Ferritin-like (InterPro:IPR009040), Ferritin, conserved site (InterPro:IPR014034), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Ferritin and Dps (InterPro:IPR008331); BEST Arabidopsis thaliana protein match is: ATFER4 (ferritin 4); binding / ferric iron binding / oxidoreductase/ transition metal ion binding (TAIR:AT2G40300.1); Has 2388 Blast hits to 2383 proteins in 603 species: Archae - 119; Bacteria - 761; Metazoa - 1101; Fungi - 6; Plants - 217; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 3462651-3463850)

Genome position     
from initiation codon
AT3G11040.1         
TSS from cDNA
TSS information
AT3G11050.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G11050.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCTCTCT+34636243463635-27-16
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCTAAA+34633473463354-304-297
 AtREG430GGCCTAAA PPDB Motif  PLACE Motif 
REGGGCTTTAA+34633673463374-284-277
 AtREG545GGCTTTAA PPDB Motif  PLACE Motif 
REGGGGTCGGGTT+34633823463391-269-260
 AtREG442GGGTCGGG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405 GGTCGGGT  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG580  GTCGGGTT PPDB MotifCCGAC  PLACE MotifCCGAC 
REGATCCGGTTT+34633953463403-256-248
 AtREG561ATCCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCCACGTGTCC+34635053463516-146-135
 AtREG627TTCCACGT     PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG382  CCACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG366   CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG472    ACGTGTCCABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGCCACGTCAT+34635303463538-121-113
 AtREG419CCACGTCA  PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG483 CACGTCAT PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.