PlantPromoterDB promoter information of AT3G11400.1
Summary of Gene (AT3G11400.1)
|
Overview
|
Focused view (chromosome 3: 3577536-3578735)
|
Genome position
from initiation codon AT3G11400.2 TSS from cDNA TSS information AT3G11400.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G11400.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 8 | + | 3578468 | -68 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | C | clone | + | 3578406 | -130 |
| TSS clone | A | clone | + | 3578425 | -111 |
| TSS clone | C | clone | + | 3578426 | -110 |
| TSS clone | C | clone | + | 3578428 | -108 |
| TSS clone | T | clone | + | 3578459 | -77 |
| TSS clone | T | clone | + | 3578462 | -74 |
| TSS clone | T | clone | + | 3578465 | -71 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTTCTTCTTCTTCGTCTTCTTCTTC | + | 3578455 | 3578479 | -81 | -57 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AAAAGCCCAAAA | + | 3578234 | 3578245 | -302 | -291 | |||
| AtREG409 | AAAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG376 | AAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG407 | AAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG469 | AGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG529 | GCCCAAAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | GGGCCTGG | + | 3578300 | 3578307 | -236 | -229 | |||
| AtREG619 | GGGCCTGG | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| REG | TCAAAACG | + | 3578395 | 3578402 | -141 | -134 | |||
| AtREG653 | TCAAAACG | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| REG | TTCCGGTTA | + | 3578408 | 3578416 | -128 | -120 | |||
| AtREG534 | TTCCGGTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG621 | TCCGGTTA | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||