PlantPromoterDB promoter information of AT3G12090.1
Summary of Gene (AT3G12090.1)
|
Overview
|
Focused view (chromosome 3: 3848214-3847015)
|
Genome position
from initiation codon AT3G12070.2 TSS from cDNA TSS information AT3G12090.1 5'->3' (-) Promoter sequence AT3G12080.1
AT3G12080.2 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G12090.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 4 | - | 3853729 | -15 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 3853720 | -6 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TTTCTTCTT | - | 3853730 | 3853738 | -16 | -24 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CCCAATTG | - | 3853880 | 3853887 | -166 | -173 | |||
| AtREG647 | CCCAATTG | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone | G | clone | + | 3847792 | AT3G12080.1, AT3G12080.2 |
| TSS clone peak | T | clone | + | 3847793 | AT3G12080.1, AT3G12080.2 |
| TSS clone | C | clone | + | 3847842 | AT3G12080.1, AT3G12080.2 |
| TSS clone peak | A | clone | - | 3847562 | AT3G12070.1, AT3G12070.2 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTTCTCTTCTCT | - | 3847522 | 3847533 | AT3G12070.1, AT3G12070.2 | |
| Y Patch | TCTTCTTC | - | 3847568 | 3847575 | AT3G12070.1, AT3G12070.2 | |
| Y Patch | TTTCTTCTTCTTCTTCTCTT | + | 3847812 | 3847831 | AT3G12080.1, AT3G12080.2 | |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | TTTTGGGC | + | 3847552 | 3847559 | AT3G12080.1, AT3G12080.2 | ||||
| AtREG529 | TTTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | CTAAACCGAA | + | 3847628 | 3847637 | AT3G12080.1, AT3G12080.2 | ||||
| AtREG511 | CTAAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG514 | TAAACCGA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG568 | AAACCGAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | TTGAACCG | + | 3847657 | 3847664 | AT3G12080.1, AT3G12080.2 | ||||
| AtREG640 | TTGAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | TTAAACCGGTTCATCCGGTTC | + | 3847726 | 3847746 | AT3G12080.1, AT3G12080.2 | ||||
| AtREG473 | TTAAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG412 | TAAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG436 | AAACCGGT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG528 | ACCGGTTC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG480 | CCGGTTCA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG561 | ATCCGGTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG579 | TCCGGTTC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | TTCGGTTTAG | - | 3847628 | 3847637 | AT3G12070.1, AT3G12070.2 | ||||
| AtREG568 | TTCGGTTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG514 | TCGGTTTA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG511 | CGGTTTAG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | CGGTTCAA | - | 3847657 | 3847664 | AT3G12070.1, AT3G12070.2 | ||||
| AtREG640 | CGGTTCAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | GAACCGGATGAACCGGTTTAA | - | 3847726 | 3847746 | AT3G12070.1, AT3G12070.2 | ||||
| AtREG579 | GAACCGGA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG561 | AACCGGAT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG480 | TGAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG528 | GAACCGGT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG436 | ACCGGTTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG412 | CCGGTTTA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG473 | CGGTTTAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||