PlantPromoterDB promoter information of AT3G12090.1

Summary of Gene (AT3G12090.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G12090  TAIR      NCBI 
Gene model AT3G12090.1  
Description Member of TETRASPANIN family  


Focused view (chromosome 3: 3848764-3847565)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT3G12090.1                      5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT3G12090.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
TSS peakG4-3853729-15

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS cloneAclone-3853720-6

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTT-38537303853738-16-24

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS cloneGclone+3847792AT3G12080.1, AT3G12080.2
TSS clone peakTclone+3847793AT3G12080.1, AT3G12080.2
TSS cloneCclone+3847842AT3G12080.1, AT3G12080.2

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTTCTTCTTCTCTT+38478123847831AT3G12080.1, AT3G12080.2
Y PatchTCTTCTTC-38475683847575AT3G12070.1, AT3G12070.2

REG information

TypeSequenceAnnotationGenome positionGene model
REGCTAAACCGAA+38476283847637AT3G12080.1, AT3G12080.2
REGTTGAACCG+38476573847664AT3G12080.1, AT3G12080.2
REGTTAAACCGGTTCATCCGGTTC+38477263847746AT3G12080.1, AT3G12080.2
 AtREG473TTAAACCG              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528    ACCGGTTC          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480     CCGGTTCA         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561            ATCCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579             TCCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTTAG-38476283847637AT3G12070.1, AT3G12070.2
REGCGGTTCAA-38476573847664AT3G12070.1, AT3G12070.2
REGGAACCGGATGAACCGGTTTAA-38477263847746AT3G12070.1, AT3G12070.2
 AtREG579GAACCGGA              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561 AACCGGAT             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480        TGAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528         GAACCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436           ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412            CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473             CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.