version
PlantPromoterDB promoter information of AT3G12090.1

Summary of Gene (AT3G12090.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G12090  TAIR      NCBI 
Gene model AT3G12090.1  
Description Member of TETRASPANIN family  
#
#

Overview

Focused view (chromosome 3: 3858214-3857015)

Genome position     
from initiation codon
AT3G12100.1         
AT3G12100.2         
TSS from cDNA
TSS information
AT3G12090.1                      5'->3' (-)
Promoter sequence








 
AT3G12110.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G12090.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-3853729-15

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-3853720-6

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTT-38537303853738-16-24
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCAATTG-38538803853887-166-173
 AtREG647CCCAATTG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8+3857854AT3G12110.1
TSS peakG4-3857319AT3G12100.1, AT3G12100.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-3857319AT3G12100.1, AT3G12100.2
TSS cloneTclone-3857318AT3G12100.1, AT3G12100.2
TSS cloneTclone+3857843AT3G12110.1
TSS cloneAclone+3857854AT3G12110.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTTCTTC+38578433857853AT3G12110.1
Y PatchTTTCTCTCTC+38578643857873AT3G12110.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGCCCATTAA+38575623857571AT3G12110.1
 AtREG372AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357 GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396  CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGACGGGCCTATT+38577973857807AT3G12110.1
 AtREG429ACGGGCCT    PPDB MotifACGGGC  PLACE MotifGGGCC 
 AtREG362  GGGCCTAT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG424   GGCCTATT PPDB Motif  PLACE Motif 
REGGTGGCCCATTG-38573593857369AT3G12100.1, AT3G12100.2
 AtREG445GTGGCCCA    PPDB MotifGCCCA  PLACE MotifGCCAC, GGGCC, TGGGCY 
 AtREG490 TGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361  GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG551   GCCCATTG PPDB MotifGCCCA  PLACE Motif 
REGTATATGGGCTTAG-38573743857386AT3G12100.1, AT3G12100.2
 AtREG620TATATGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG477  TATGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG634     GGGCTTAG PPDB MotifGCCCA  PLACE Motif 
REGTATGGGCTTC-38573953857404AT3G12100.1, AT3G12100.2
 AtREG477TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476  TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTAATGGGCT-38575083857517AT3G12100.1, AT3G12100.2
 AtREG396TTAATGGG   PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCTTAATGGG-38575423857550AT3G12100.1, AT3G12100.2
 AtREG604CTTAATGG  PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTTAATGGGCT-38575623857571AT3G12100.1, AT3G12100.2
 AtREG396TTAATGGG   PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.