version
PlantPromoterDB promoter information of AT3G13030.3

Summary of Gene (AT3G13030.3)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G13030  TAIR      NCBI 
Gene model AT3G13030.3  
Description hAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Protein of unknown function DUF659 (InterPro:IPR007021); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G13020.1); Has 392 Blast hits to 369 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 4172417-4171218)

Genome position     
from initiation codon
AT3G13030.1         
AT3G13030.2         
AT3G13040.1         
AT3G13040.2         
TSS from cDNA
TSS information
AT3G13030.3                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G13030.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4172051-634
TSS clone peakAclone-4172029-612
TSS clone peakGclone-4171778-361

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxACTATATA-41718084171815-391-398
Y PatchTTCCTCTCTTTCTCC-41717544171768-337-351
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTATATGGG-41718494171856-432-439
 AtREG620TATATGGG PPDB MotifGCCCA  PLACE Motif 
REGAAAGTCAA-41719964172003-579-586
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGACGTGGAA-41721524172159-735-742
 AtREG627ACGTGGAA PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.