version
PlantPromoterDB promoter information of AT3G13672.1

Summary of Gene (AT3G13672.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G13672  TAIR      NCBI 
Gene model AT3G13672.1  
Description seven in absentia (SINA) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: multicellular organismal development, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), Seven in absentia protein, TRAF-like domain (InterPro:IPR018121), Seven in absentia protein (InterPro:IPR004162), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: SINAT2 (SEVEN IN ABSENTIA OF ARABIDOPSIS 2); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G58040.1); Has 352 Blast hits to 352 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 218; Fungi - 0; Plants - 128; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 4469293-4468094)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G13672.1                      5'->3' (-)
Promoter sequence

 
AT3G13662.1         
AT3G13670.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G13672.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4474378-35

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCCTCTTTC-44743844474397-41-54
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCAATTG-44746714474678-328-335
 AtREG647CCCAATTG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA13+4469241AT3G13670.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+4469222AT3G13670.1
TSS cloneTclone+4469223AT3G13670.1
TSS cloneTclone+4469235AT3G13670.1
TSS cloneTclone+4469238AT3G13670.1
TSS cloneTclone+4469242AT3G13670.1
TSS cloneTclone+4469252AT3G13670.1
TSS cloneAclone+4469282AT3G13670.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTCTCTCC+44692114469221AT3G13670.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTGACGTGGCAT+44691674469178AT3G13670.1
 AtREG440CTGACGTG    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419 TGACGTGG    PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG388  GACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379   ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG448    CGTGGCATABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.