PlantPromoterDB promoter information of AT3G14010.1
Summary of Gene (AT3G14010.1)
|
Overview
|
Focused view (chromosome 3: 4636164-4637363)
|
Genome position
from initiation codon AT3G14010.3 TSS from cDNA TSS information AT3G14010.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G14010.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 8 | + | 4636367 | -797 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | G | clone | + | 4636367 | -797 |
| TSS clone | A | clone | + | 4636368 | -796 |
| TSS clone | T | clone | + | 4636427 | -737 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTTTCCT | + | 4636354 | 4636361 | -810 | -803 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CTTAATGG | + | 4636135 | 4636142 | -1029 | -1022 | |||
| AtREG604 | CTTAATGG | PPDB Motif | PLACE Motif | TTAATGG | |||||
| REG | AGGCCTATA | + | 4636221 | 4636229 | -943 | -935 | |||
| AtREG649 | AGGCCTAT | PPDB Motif | PLACE Motif | ||||||
| AtREG487 | GGCCTATA | PPDB Motif | PLACE Motif | ||||||
| REG | TAGCCCAT | + | 4636251 | 4636258 | -913 | -906 | |||
| AtREG581 | TAGCCCAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| REG | TGAGCCCATTAAGGCCCAAAT | + | 4636261 | 4636281 | -903 | -883 | |||
| AtREG485 | TGAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG372 | AGCCCATT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG357 | GCCCATTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG396 | CCCATTAA | PPDB Motif | GCCCA | PLACE Motif | TTAATGG | ||||
| AtREG604 | CCATTAAG | PPDB Motif | PLACE Motif | TTAATGG | |||||
| AtREG416 | TTAAGGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG351 | TAAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG353 | AAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | AGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG373 | GGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG421 | GCCCAAAT | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||