version
PlantPromoterDB promoter information of AT3G14180.1

Summary of Gene (AT3G14180.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G14180  TAIR      NCBI 
Gene model AT3G14180.1  
Description transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 4709621-4708422)

Genome position     
from initiation codon
AT3G14185           
AT3G14185.1         
TSS from cDNA
TSS information
AT3G14180.1                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G14180.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-4708882-261
TSS clone peakCclone-4708853-232
TSS cloneAclone-4708848-227
TSS cloneCclone-4708659-38
TSS clone peakAclone-4708658-37
TSS cloneCclone-4708657-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCTTTC-47086594708669-38-48
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTACCCCT-47087054708712-84-91
 AtREG642TTACCCCT PPDB MotifACCCCT  PLACE Motif 
REGGACGCCGT-47087244708731-103-110
 AtREG540GACGCCGT PPDB Motif  PLACE Motif 
REGTTCCACGTGTCC-47087444708755-123-134
 AtREG627TTCCACGT     PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG382  CCACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG366   CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG472    ACGTGTCCABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGCACGTCATTCCACGTCATC-47087774708795-156-174
 AtREG483CACGTCAT  CACGTCAT  PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG627       TTCCACGT     PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419         CCACGTCA   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG578           ACGTCATCABA PPDB MotifACGT  PLACE MotifACGT 
REGTTACCCCTAAACCGA-47088424708856-221-235
 AtREG642TTACCCCT        PPDB MotifACCCCT  PLACE Motif 
 AtREG511      CTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514       TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAGATGGGCTTTT-47089204708931-299-310
 AtREG572AGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG378  ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGACCGGAAA-47089724708979-351-358
 AtREG644ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAAGGGTA-47089934709000-372-379
 AtREG570TAAGGGTA PPDB MotifACCCT  PLACE Motif 
REGCTGACGGT-47090064709013-385-392
 AtREG625CTGACGGT PPDB Motif  PLACE Motif 
REGATCCACGTCAC-47091334709143-512-522
 AtREG547ATCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419  CCACGTCA  PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG466   CACGTCACABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.