version
PlantPromoterDB promoter information of AT3G15660.1

Summary of Gene (AT3G15660.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G15660  TAIR      NCBI 
Gene model AT3G15660.1  
Description GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 5310383-5309184)

Genome position     
from initiation codon
AT3G15660.2         
AT3G15670.1         
TSS from cDNA
TSS information
AT3G15660.1                      5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G15660.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC8-5309516-133

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-5309556-173
TSS cloneGclone-5309553-170
TSS cloneCclone-5309518-135
TSS cloneAclone-5309493-110

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCTCT-53094815309488-98-105
Y PatchCCTTCTTCCTC-53094965309506-113-123
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGACACGACGTCGTT-53095715309586-188-203
 AtREG438ATGACACG        ABA PPDB Motif  PLACE Motif 
 AtREG431     ACGACGTCGT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG493        ACGTCGTT PPDB MotifACGT  PLACE MotifACGT 
REGGAAACGACATCG-53096115309622-228-239
 AtREG576GAAACGAC     PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA    PPDB Motif  PLACE Motif 
 AtREG630    CGACATCG PPDB Motif  PLACE Motif 
REGCTAAACCGA-53096785309686-295-303
 AtREG511CTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.