version
PlantPromoterDB promoter information of AT3G15690.1

Summary of Gene (AT3G15690.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G15690  TAIR      NCBI 
Gene model AT3G15690.1  
Description biotin carboxyl carrier protein of acetyl-CoA carboxylase-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin/lipoyl attachment domain-containing protein (TAIR:AT1G52670.1); Has 1999 Blast hits to 1999 proteins in 727 species: Archae - 2; Bacteria - 1353; Metazoa - 8; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 5316108-5317307)

Genome position     
from initiation codon
AT3G15680.1         
AT3G15690.2         
TSS from cDNA
TSS information
AT3G15690.1                      5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G15690.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+5317000-108

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+5316941-167
TSS cloneAclone+5316949-159

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCAATAATGGGCTTATATGGGCTATAAAGGCCCAAAT+53168365316875-272-233
 AtREG446GGGCCAAT                                CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG546      ATAATGGG                           PPDB Motif  PLACE Motif 
 AtREG357       TAATGGGC                          PPDB MotifGCCCA  PLACE Motif 
 AtREG372        AATGGGCT                         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378         ATGGGCTT                        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426          TGGGCTTA                       PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462           GGGCTTAT                      PPDB MotifGCCCA  PLACE Motif 
 AtREG620                TATATGGG                 PPDB MotifGCCCA  PLACE Motif 
 AtREG432                 ATATGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG477                  TATGGGCT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581                   ATGGGCTA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG467                           TAAAGGCC      PPDB Motif  PLACE Motif 
 AtREG359                            AAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353                             AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356                              AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373                               GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421                                GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGAACGACGA+53169525316959-156-149
 AtREG648AACGACGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.