version
PlantPromoterDB promoter information of AT3G16200.1

Summary of Gene (AT3G16200.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G16200  TAIR      NCBI 
Gene model AT3G16200.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 70 Blast hits to 70 proteins in 9 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 5494605-5493406)

Genome position     
from initiation codon
AT3G16210.1         
TSS from cDNA
TSS information
AT3G16200.1                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G16200.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-5493629-24
TSS clone peakAclone-5493618-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGGTTTT-54936995493706-94-101
 AtREG542CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAACCGGTTTGGGCT-54937095493723-104-118
 AtREG503TAACCGGT        PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG436  ACCGGTTT      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496   CCGGTTTG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550    CGGTTTGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG474      GTTTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG469       TTTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCCGGTTTGG-54937565493764-151-159
 AtREG496CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550 CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCACGCGCC-54938635493870-258-265
 AtREG486CACGCGCC PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.