version
PlantPromoterDB promoter information of AT3G17630.1

Summary of Gene (AT3G17630.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G17630  TAIR      NCBI 
Gene model AT3G17630.1  
Description member of Putative Na+/H+ antiporter family  
#
#

Overview

Focused view (chromosome 3: 6026751-6027950)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G17630.1                      5'->3' (+)
Promoter sequence













 
AT3G17620.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G17630.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGGGCCGAA+60278026027810AT3G17626.1
 AtREG393TGGGCCGA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG427 GGGCCGAA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTGTCGTTTC+60278816027889AT3G17626.1
 AtREG569TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576 GTCGTTTC PPDB Motif  PLACE Motif 
REGTTATGGGCTTTATTATTGGGCTTTTAGCCCAACT+60278926027925AT3G17626.1
 AtREG394TTATGGGC                           PPDB MotifGCCCA  PLACE Motif 
 AtREG477 TATGGGCT                          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT                         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT     TGGGCTTT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA                       PPDB MotifGCCCA  PLACE Motif 
 AtREG601     GGCTTTAT                      PPDB Motif  PLACE Motif 
 AtREG417            TTATTGGG               PPDB MotifGCCCA  PLACE Motif 
 AtREG355             TATTGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG402              ATTGGGCT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407               TTGGGCTT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409                 GGGCTTTT          PPDB MotifGCCCA  PLACE Motif 
 AtREG549                  GGCTTTTA         PPDB Motif  PLACE Motif 
 AtREG571                       TTAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574                         AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG607                          GCCCAACT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.