version
PlantPromoterDB promoter information of AT3G17660.1

Summary of Gene (AT3G17660.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G17660  TAIR      NCBI 
Gene model AT3G17660.1  
Description A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes; AGD15 belongs to the class 4, together with AGD14.  
#
#

Overview

Focused view (chromosome 3: 6043617-6044816)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G17660.1                      5'->3' (+)
Promoter sequence

 
AT3G17680.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G17660.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+6037598-119

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGATATAAAAG+60375636037572-154-145
Y PatchTTTCTCTCCTCTCCTTC+60375956037611-122-106
Y PatchTTCTTCCT+60376196037626-98-91
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAATTGGG+60374276037434-290-283
 AtREG647CAATTGGG PPDB Motif  PLACE Motif 
REGGTCGGGTT+60374716037478-246-239
 AtREG580GTCGGGTT PPDB MotifCCGAC  PLACE MotifCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4-6044495AT3G17680.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-6044504AT3G17680.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTTC-60444466044453AT3G17680.1
Y PatchTCTTCTCTCTCTC-60444736044485AT3G17680.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAGCCACGTGTT-60445826044593AT3G17680.1
 AtREG608AAGCCACG    ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG450 AGCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG382   CCACGTGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG590    CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGCAATGGGCCG-60446166044625AT3G17680.1
 AtREG551CAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380  ATGGGCCG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTAAGCCCAACA-60446286044638AT3G17680.1
 AtREG426TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG543   GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.