PlantPromoterDB promoter information of AT3G17790

Summary of Gene (AT3G17790)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G17790 TAIR NCBI
Gene model	AT3G17790
Description	PAP17; FUNCTIONS IN: phosphatase activity, protein serine/threonine phosphatase activity, acid phosphatase activity; INVOLVED IN: response to hydrogen peroxide, cellular phosphate ion homeostasis; LOCATED IN: cell surface; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: PAP3 (PURPLE ACID PHOSPHATASE 3); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT1G14700.1); Has 911 Blast hits to 906 proteins in 224 species: Archae - 2; Bacteria - 200; Metazoa - 324; Fungi - 6; Plants - 95; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 6088779-6089978)

`Genome position from initiation codon` `AT3G17790.1 TSS from cDNA TSS information AT3G17790 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G17790

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 44 + 6089605 -174

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	44	+	6089605	-174

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone + 6089606 -173

TSS clone T clone + 6089609 -170

TSS clone A clone + 6089717 -62

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	+	6089606	-173
TSS clone	`T`	clone	+	6089609	-170
TSS clone	`A`	clone	+	6089717	-62

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTCCCTCCTTCT + 6089590 6089601 -189 -178

Y Patch TTCTCTTCTTCTC + 6089634 6089646 -145 -133

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTCCCTCCTTCT`	+	6089590	6089601	-189	-178
Y Patch	`TTCTCTTCTTCTC`	+	6089634	6089646	-145	-133
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TTTAACCG + 6089507 6089514 -272 -265

AtREG645 TTTAACCG PPDB Motif AACCG(G/A) PLACE Motif CNGTTR

REG TTTAACCG + 6089545 6089552 -234 -227

AtREG645 TTTAACCG PPDB Motif AACCG(G/A) PLACE Motif CNGTTR

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TTTAACCG`		+	6089507	6089514	-272	-265
	AtREG645	`TTTAACCG`		PPDB Motif	`AACCG(G/A)`	PLACE Motif	`CNGTTR`
REG	`TTTAACCG`		+	6089545	6089552	-234	-227
	AtREG645	`TTTAACCG`		PPDB Motif	`AACCG(G/A)`	PLACE Motif	`CNGTTR`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None