version
PlantPromoterDB promoter information of AT3G18790.1

Summary of Gene (AT3G18790.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G18790  TAIR      NCBI 
Gene model AT3G18790.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isy1-like splicing (InterPro:IPR009360); Has 1075 Blast hits to 879 proteins in 176 species: Archae - 8; Bacteria - 11; Metazoa - 379; Fungi - 177; Plants - 27; Viruses - 9; Other Eukaryotes - 464 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 6471103-6472302)

Genome position     
from initiation codon
AT3G18777.1         
TSS from cDNA
TSS information
AT3G18790.1                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G18790.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+6477731-122

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+6477699-154
TSS cloneAclone+6477738-115
TSS cloneAclone+6477739-114

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTCTCTTCC+64777016477712-152-141
Y PatchCGTCTCTCCTTCTC+64777146477727-139-126
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGTCAA+64774866477493-367-360
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGCTTGGGCCCTA+64775326477542-321-311
 AtREG505CTTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392 TTGGGCCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG400  TGGGCCCT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG387   GGGCCCTA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTATATGGGCTAA+64775786477589-275-264
 AtREG620TATATGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477  TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG571    TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAATTGGGCCTTAG+64775926477604-261-249
 AtREG418AATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352 ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351    GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG577     GGCCTTAG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.