PlantPromoterDB promoter information of AT3G18820.1

Summary of Gene (AT3G18820.1)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G18820 TAIR NCBI
Gene model	AT3G18820.1
Description	ARABIDOPSIS RAB GTPASE HOMOLOG G3F (ATRAB7B); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: RABG3E (RAB GTPASE HOMOLOG G3E); GTP binding (TAIR:AT1G49300.2); Has 21200 Blast hits to 21171 proteins in 622 species: Archae - 28; Bacteria - 122; Metazoa - 11542; Fungi - 2814; Plants - 1791; Viruses - 19; Other Eukaryotes - 4884 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 6478916-6480115)

`Genome position from initiation codon` `AT3G18790.1 AT3G18800.1 TSS from cDNA TSS information AT3G18820.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G18820.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 5 + 6484159 -107

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	5	+	6484159	-107

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 6484101 -165

TSS clone G clone + 6484138 -128

TSS clone G clone + 6484160 -106

TSS clone A clone + 6484179 -87

TSS clone T clone + 6484185 -81

TSS clone A clone + 6484199 -67

TSS clone C clone + 6484213 -53

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	6484101	-165
TSS clone	`G`	clone	+	6484138	-128
TSS clone	`G`	clone	+	6484160	-106
TSS clone	`A`	clone	+	6484179	-87
TSS clone	`T`	clone	+	6484185	-81
TSS clone	`A`	clone	+	6484199	-67
TSS clone	`C`	clone	+	6484213	-53

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CGTCTTCTTC + 6484189 6484198 -77 -68

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CGTCTTCTTC`	+	6484189	6484198	-77	-68
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 4 + 6479697 AT3G18800.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	4	+	6479697	AT3G18800.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone C clone + 6479675 AT3G18800.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`C`	clone	+	6479675	AT3G18800.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CATCTCTC + 6479701 6479708 AT3G18800.1

Y Patch TTTCTCTCTTCTC + 6479724 6479736 AT3G18800.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CATCTCTC`	+	6479701	6479708	AT3G18800.1
Y Patch	`TTTCTCTCTTCTC`	+	6479724	6479736	AT3G18800.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG GACCGTTG + 6479628 6479635 AT3G18800.1

AtREG553 GACCGTTG Auxin PPDB Motif CCAACGG PLACE Motif YAACKG, CNGTTR