version
PlantPromoterDB promoter information of AT3G18850.2

Summary of Gene (AT3G18850.2)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G18850  TAIR      NCBI 
Gene model AT3G18850.2  
Description LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 6501840-6500641)

Genome position     
from initiation codon
AT3G18850.1         
AT3G18850.3         
AT3G18850.4         
AT3G18850.5         
TSS from cDNA
TSS information
AT3G18850.2                      5'->3' (-)
Promoter sequence








 
AT3G18860.1         
AT3G18860.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G18850.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-6501338-498

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCTTCT-65013536501365-513-525
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTAATTA-65014356501442-595-602
 AtREG646CGTAATTAABA PPDB Motif  PLACE Motif 
REGGATGACGTGTCG-65015326501543-692-703
 AtREG578GATGACGT    ABA PPDB MotifACGT  PLACE MotifACGT 
 AtREG483 ATGACGTG    PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517  TGACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG481   GACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG478    ACGTGTCGABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGGTGGGCTTTCAAAGCCCGGCCCAATTG-65015916501617-751-777
 AtREG518GTGGGCTT                    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376 TGGGCTTT                   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559         CAAAGCCC           PPDB MotifGCCCA  PLACE Motif 
 AtREG404              CCCGGCCC     CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG457               CCGGCCCA    CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414                CGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352                 GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418                  GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG647                   CCCAATTG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA18+6501686AT3G18860.1, AT3G18860.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+6501680AT3G18860.1, AT3G18860.2
TSS cloneCclone+6501685AT3G18860.1, AT3G18860.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTATATAAAAG+65016426501654AT3G18860.1, AT3G18860.2
Y PatchTCTCCTTCCTC+65016946501704AT3G18860.1, AT3G18860.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAATTACG+65014356501442AT3G18860.1, AT3G18860.2
 AtREG646TAATTACGABA PPDB Motif  PLACE Motif 
REGCGACACGTCATC+65015326501543AT3G18860.1, AT3G18860.2
 AtREG478CGACACGT    ABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG481 GACACGTC   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG517  ACACGTCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG483   CACGTCAT  PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG578    ACGTCATCABA PPDB MotifACGT  PLACE MotifACGT 
REGCAATTGGGCCGGGCTTTGAAAGCCCAC+65015916501617AT3G18860.1, AT3G18860.2
 AtREG647CAATTGGG                    PPDB Motif  PLACE Motif 
 AtREG418 AATTGGGC                   PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC                  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414   TTGGGCCG                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG457    TGGGCCGG               CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG404     GGGCCGGG              CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG559          GGGCTTTG          PPDB MotifGCCCA  PLACE Motif 
 AtREG376                  AAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518                   AAGCCCAC PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.