version
PlantPromoterDB promoter information of AT3G20460

Summary of Gene (AT3G20460)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G20460  TAIR      NCBI 
Gene model AT3G20460  
Description sugar transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: sugar transporter, putative (TAIR:AT3G05165.3); Has 17047 Blast hits to 16548 proteins in 1166 species: Archae - 244; Bacteria - 5638; Metazoa - 4631; Fungi - 4215; Plants - 1317; Viruses - 0; Other Eukaryotes - 1002 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 7130250-7131449)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G20460                        5'->3' (+)
Promoter sequence

 
AT3G20440.1         
AT3G20440.2         
AT3G20450.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G20460

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC5+7134979-71

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATAATG+71349487134955-102-95
Y PatchTCTTTCCT+71349957135002-55-48
Y PatchCTCTCTCTCT+71350187135027-32-23
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTCAT+71349117134918-139-132
 AtREG483CACGTCAT PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone-7131268AT3G20440.1, AT3G20440.2, AT3G20450.1
TSS cloneAclone-7130436AT3G20440.1, AT3G20440.2
TSS clone peakTclone-7130435AT3G20440.1, AT3G20440.2
TSS cloneGclone-7130404AT3G20440.1, AT3G20440.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTTC-71303807130387AT3G20440.1, AT3G20440.2
Y PatchCCTCTCTT-71304377130444AT3G20440.1, AT3G20440.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCGTCGTT-71304697130476AT3G20440.1, AT3G20440.2
 AtREG648TCGTCGTT PPDB Motif  PLACE Motif 
REGCGGTTTGG-71305237130530AT3G20440.1, AT3G20440.2
 AtREG550CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTGAACCGGTTTAA-71305397130552AT3G20440.1, AT3G20440.2
 AtREG640TTGAACCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 TGAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528  GAACCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436    ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412     CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473      CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTCGGTTCGG-71305557130563AT3G20440.1, AT3G20440.2
 AtREG575TCGGTTCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456 CGGTTCGG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.