PlantPromoterDB promoter information of AT3G20870.1
Summary of Gene (AT3G20870.1)
|
Overview
|
Focused view (chromosome 3: 7313476-7312277)
|
Genome position
from initiation codon TSS from cDNA TSS information AT3G20870.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G20870.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 7312748 | -272 |
| TSS clone | A | clone | - | 7312733 | -257 |
| TSS clone peak | A | clone | - | 7312726 | -250 |
| TSS clone | A | clone | - | 7312698 | -222 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | CGTCTATATATC | - | 7312567 | 7312578 | -91 | -102 |
| Y Patch | TTCTCTTC | - | 7312584 | 7312591 | -108 | -115 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TTCGGGTCA | - | 7312791 | 7312799 | -315 | -323 | |||
| AtREG597 | TTCGGGTC | PPDB Motif | GGGACCC | PLACE Motif | |||||
| AtREG617 | TCGGGTCA | PPDB Motif | PLACE Motif | ||||||
| REG | ACCGGGTTAAACCGACCCGA | - | 7312806 | 7312825 | -330 | -349 | |||
| AtREG516 | ACCGGGTT | PPDB Motif | PLACE Motif | ||||||
| AtREG473 | TTAAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG514 | TAAACCGA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG375 | CCGACCCG | PPDB Motif | CCGAC | PLACE Motif | CCGAC | ||||
| AtREG383 | CGACCCGA | PPDB Motif | PLACE Motif | ||||||
| REG | AACCCGGTT | - | 7312837 | 7312845 | -361 | -369 | |||
| AtREG516 | AACCCGGT | PPDB Motif | PLACE Motif | ||||||
| AtREG455 | ACCCGGTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||