PlantPromoterDB promoter information of AT3G21670

Summary of Gene (AT3G21670)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G21670 TAIR NCBI
Gene model	AT3G21670
Description	nitrate transporter (NTP3); FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nitrate transporter (NTP2) (TAIR:AT2G26690.1); Has 4540 Blast hits to 4334 proteins in 779 species: Archae - 0; Bacteria - 2064; Metazoa - 555; Fungi - 289; Plants - 1121; Viruses - 0; Other Eukaryotes - 511 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 7629954-7628755)

`Genome position from initiation codon` `AT3G21670.1 TSS from cDNA TSS information AT3G21670 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G21670

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak A clone - 7629151 -197

TSS clone T clone - 7629025 -71

TSS clone peak G clone - 7628978 -24

TSS clone A clone - 7628977 -23

TSS clone A clone - 7628972 -18

TSS clone A clone - 7628971 -17

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`A`	clone	-	7629151	-197
TSS clone	`T`	clone	-	7629025	-71
TSS clone peak	`G`	clone	-	7628978	-24
TSS clone	`A`	clone	-	7628977	-23
TSS clone	`A`	clone	-	7628972	-18
TSS clone	`A`	clone	-	7628971	-17

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CCTTATAA - 7629006 7629013 -52 -59

TATA Box TTTATATAAAGA - 7629176 7629187 -222 -233

Y Patch CTTTCTTCTCTC - 7628980 7628991 -26 -37

Y Patch CTTCTCCT - 7629011 7629018 -57 -64

Y Patch TCTCCTCT - 7629114 7629121 -160 -167

Y Patch CATCTCTCTTC - 7629142 7629152 -188 -198

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CCTTATAA`	-	7629006	7629013	-52	-59
TATA Box	`TTTATATAAAGA`	-	7629176	7629187	-222	-233
Y Patch	`CTTTCTTCTCTC`	-	7628980	7628991	-26	-37
Y Patch	`CTTCTCCT`	-	7629011	7629018	-57	-64
Y Patch	`TCTCCTCT`	-	7629114	7629121	-160	-167
Y Patch	`CATCTCTCTTC`	-	7629142	7629152	-188	-198
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG GCCCATTT - 7629130 7629137 -176 -183

AtREG386 GCCCATTT PPDB Motif GCCCA PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`GCCCATTT`		-	7629130	7629137	-176	-183
	AtREG386	`GCCCATTT`		PPDB Motif	`GCCCA`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None