version
PlantPromoterDB promoter information of AT3G23490.1

Summary of Gene (AT3G23490.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G23490  TAIR      NCBI 
Gene model AT3G23490.1  
Description cyanase  
#
#

Overview

Focused view (chromosome 3: 8420865-8419666)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G23490.1                      5'->3' (-)
Promoter sequence

 
AT3G23480.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G23490.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG49-8424426-11

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-8424461-46
TSS cloneAclone-8424458-43
TSS cloneGclone-8424430-15
TSS cloneAclone-8424429-14
TSS cloneTclone-8424428-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCAGCCCATTTA-84244938424504-78-89
 AtREG609TCAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386   GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443    CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGCCCATTAT-84245198424526-104-111
 AtREG546CCCATTAT PPDB Motif  PLACE Motif 
REGCCCATTTAAAAGCCCATTTA-84245318424550-116-135
 AtREG443CCCATTTA    CCCATTTA PPDB MotifGCCCA  PLACE Motif 
 AtREG549      TAAAAGCC       PPDB Motif  PLACE Motif 
 AtREG409       AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376        AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378         AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372          AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386           GCCCATTT  PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.