PlantPromoterDB promoter information of AT3G23490.1
Summary of Gene (AT3G23490.1)
|
Overview
|
Focused view (chromosome 3: 8425565-8424366)
|
Genome position
from initiation codon TSS from cDNA TSS information AT3G23490.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G23490.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 49 | - | 8424426 | -11 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | - | 8424461 | -46 |
| TSS clone | A | clone | - | 8424458 | -43 |
| TSS clone | G | clone | - | 8424430 | -15 |
| TSS clone | A | clone | - | 8424429 | -14 |
| TSS clone | T | clone | - | 8424428 | -13 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TCAGCCCATTTA | - | 8424493 | 8424504 | -78 | -89 | |||
| AtREG609 | TCAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG372 | AGCCCATT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG386 | GCCCATTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG443 | CCCATTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | CCCATTAT | - | 8424519 | 8424526 | -104 | -111 | |||
| AtREG546 | CCCATTAT | PPDB Motif | PLACE Motif | ||||||
| REG | CCCATTTAAAAGCCCATTTA | - | 8424531 | 8424550 | -116 | -135 | |||
| AtREG443 | CCCATTTA CCCATTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG549 | TAAAAGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG409 | AAAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG376 | AAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG378 | AAGCCCAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG372 | AGCCCATT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG386 | GCCCATTT | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||