PlantPromoterDB promoter information of AT3G23810

Summary of Gene (AT3G23810)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G23810 TAIR NCBI
Gene model	AT3G23810
Description	S-ADENOSYL-L-HOMOCYSTEINE (SAH) HYDROLASE 2 (SAHH2); FUNCTIONS IN: adenosylhomocysteinase activity, binding, catalytic activity; INVOLVED IN: one-carbon compound metabolic process, metabolic process; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 32 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosyl-L-homocysteine hydrolase (InterPro:IPR000043), NAD(P)-binding (InterPro:IPR016040), S-adenosyl-L-homocysteine hydrolase, NAD binding (InterPro:IPR015878); BEST Arabidopsis thaliana protein match is: MEE58 (MATERNAL EFFECT EMBRYO ARREST 58); adenosylhomocysteinase/ copper ion binding (TAIR:AT4G13940.1); Has 6533 Blast hits to 6529 proteins in 950 species: Archae - 144; Bacteria - 1368; Metazoa - 431; Fungi - 95; Plants - 164; Viruses - 0; Other Eukaryotes - 4331 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 8591621-8590422)

`Genome position from initiation codon` `TSS from cDNA TSS information AT3G23810 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G23810

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone - 8589716 -45

TSS clone T clone - 8589713 -42

TSS clone T clone - 8589710 -39

TSS clone peak T clone - 8589709 -38

TSS clone peak A clone - 8589707 -36

TSS clone T clone - 8589706 -35

TSS clone A clone - 8589700 -29

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	-	8589716	-45
TSS clone	`T`	clone	-	8589713	-42
TSS clone	`T`	clone	-	8589710	-39
TSS clone peak	`T`	clone	-	8589709	-38
TSS clone peak	`A`	clone	-	8589707	-36
TSS clone	`T`	clone	-	8589706	-35
TSS clone	`A`	clone	-	8589700	-29

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TTCTCTTCCTCCTCCTTC - 8589708 8589725 -37 -54

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TTCTCTTCCTCCTCCTTC`	-	8589708	8589725	-37	-54
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG AAAGTCAA - 8589820 8589827 -149 -156

AtREG632 AAAGTCAA PPDB Motif PLACE Motif TTGAC

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`AAAGTCAA`		-	8589820	8589827	-149	-156
	AtREG632	`AAAGTCAA`		PPDB Motif		PLACE Motif	`TTGAC`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None