version
PlantPromoterDB promoter information of AT3G23810

Summary of Gene (AT3G23810)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G23810  TAIR      NCBI 
Gene model AT3G23810  
Description S-ADENOSYL-L-HOMOCYSTEINE (SAH) HYDROLASE 2 (SAHH2); FUNCTIONS IN: adenosylhomocysteinase activity, binding, catalytic activity; INVOLVED IN: one-carbon compound metabolic process, metabolic process; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 32 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosyl-L-homocysteine hydrolase (InterPro:IPR000043), NAD(P)-binding (InterPro:IPR016040), S-adenosyl-L-homocysteine hydrolase, NAD binding (InterPro:IPR015878); BEST Arabidopsis thaliana protein match is: MEE58 (MATERNAL EFFECT EMBRYO ARREST 58); adenosylhomocysteinase/ copper ion binding (TAIR:AT4G13940.1); Has 6533 Blast hits to 6529 proteins in 950 species: Archae - 144; Bacteria - 1368; Metazoa - 431; Fungi - 95; Plants - 164; Viruses - 0; Other Eukaryotes - 4331 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 8592121-8590922)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G23810                        5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G23810

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-8589716-45
TSS cloneTclone-8589713-42
TSS cloneTclone-8589710-39
TSS clone peakTclone-8589709-38
TSS clone peakAclone-8589707-36
TSS cloneTclone-8589706-35
TSS cloneAclone-8589700-29

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTTCCTCCTCCTTC-85897088589725-37-54
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGTCAA-85898208589827-149-156
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.