PlantPromoterDB promoter information of AT3G24120.2

Summary of Gene (AT3G24120.2)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G24120 TAIR NCBI
Gene model	AT3G24120.2
Description	myb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: UNE16 (unfertilized embryo sac 16); transcription factor (TAIR:AT4G13640.2); Has 910 Blast hits to 901 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 897; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 8697998-8696799)

`Genome position from initiation codon` `AT3G24080.1 AT3G24080.2 AT3G24090.1 TSS from cDNA TSS information AT3G24120.2 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G24120.2

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 5 - 8708327 -179

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	5	-	8708327	-179

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone - 8708187 -39

TSS clone C clone - 8708176 -28

TSS clone G clone - 8708175 -27

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	-	8708187	-39
TSS clone	`C`	clone	-	8708176	-28
TSS clone	`G`	clone	-	8708175	-27

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TATAAACA - 8708350 8708357 -202 -209

Y Patch TTCCTTCT - 8708340 8708347 -192 -199

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TATAAACA`	-	8708350	8708357	-202	-209
Y Patch	`TTCCTTCT`	-	8708340	8708347	-192	-199
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CAATTGGG - 8708593 8708600 -445 -452

AtREG647 CAATTGGG PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CAATTGGG`		-	8708593	8708600	-445	-452
	AtREG647	`CAATTGGG`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 21 - 8697124 AT3G24080.1, AT3G24080.2

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	21	-	8697124	AT3G24080.1, AT3G24080.2

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone - 8697124 AT3G24080.1, AT3G24080.2

TSS clone C clone - 8697123 AT3G24080.1, AT3G24080.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	-	8697124	AT3G24080.1, AT3G24080.2
TSS clone	`C`	clone	-	8697123	AT3G24080.1, AT3G24080.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box GTATAAATA - 8697152 8697160 AT3G24080.1, AT3G24080.2

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`GTATAAATA`	-	8697152	8697160	AT3G24080.1, AT3G24080.2
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CGAACCGA - 8697304 8697311 AT3G24080.1, AT3G24080.2

AtREG575 CGAACCGA PPDB Motif AACCG(G/A) PLACE Motif