version
PlantPromoterDB promoter information of AT3G25805.1

Summary of Gene (AT3G25805.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G25805  TAIR      NCBI 
Gene model AT3G25805.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 32 species: Archae - 0; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 9429169-9427970)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G25805.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G25805.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC20-9428227-58

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-9428193-24
TSS cloneAclone-9428189-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTC-94282279428234-58-65
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACGTCGTT-94282779428290-108-121
 AtREG520AAAACGAC       PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG      PPDB Motif  PLACE Motif 
 AtREG493  AACGACGTCGTT PPDB MotifACGT  PLACE MotifACGT 
 AtREG431   ACGACGTCGT  PPDB MotifACGT  PLACE MotifACGT 
REGTTAAAGCC-94283189428325-149-156
 AtREG545TTAAAGCC PPDB Motif  PLACE Motif 
REGTGGGCCAAT-94283339428341-164-172
 AtREG484TGGGCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG446 GGGCCAATCK PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAAACGGCGTTTTATAAGGCC-94283439428362-174-193
 AtREG524AAACGGCG             PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497 AACGGCGT            PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG650    GGCGTTTT         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564     GCGTTTTA        PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG425            ATAAGGCC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.