version
PlantPromoterDB promoter information of AT3G26400.1

Summary of Gene (AT3G26400.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G26400  TAIR      NCBI 
Gene model AT3G26400.1  
Description member of eIF4B - eukaryotic initiation factor 4B  
#
#

Overview

Focused view (chromosome 3: 9665616-9666815)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G26400.1                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G26400.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13+9665630-986
TSS peakT4+9665824-792
TSS peakA13+9666488-128

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCTCTCTTCTCTT+96656089665625-1008-991
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCCGGT+96656779665684-939-932
 AtREG644TTTCCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGGTTTAC+96657499665757-867-859
 AtREG412CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519 CGGTTTAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAGTCAACACGTGTT+96661939666208-423-408
 AtREG632AAAGTCAA         PPDB Motif  PLACE MotifTTGAC 
 AtREG590      AACACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGCTAATGGGCTATTGTTGGGCTC+96662579666278-359-338
 AtREG558CTAATGGG               PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG584     GGGCTATT          PPDB MotifGCCCA  PLACE Motif 
 AtREG543            TGTTGGGC   PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG574             GTTGGGCT  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG533              TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGGCTTTAA+96663069666313-310-303
 AtREG545GGCTTTAA PPDB Motif  PLACE Motif 
REGAGCGCGTGA+96663779666385-239-231
 AtREG381AGCGCGTG  PPDB MotifACGCGC  PLACE Motif 
 AtREG395 GCGCGTGA PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.