version
PlantPromoterDB promoter information of AT3G26410.1

Summary of Gene (AT3G26410.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G26410  TAIR      NCBI 
Gene model AT3G26410.1  
Description methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 9672273-9671074)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G26410.1                      5'->3' (-)
Promoter sequence














 
AT3G26420.1         
AT3G26430.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence














 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G26410.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-9671296-23

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-9671348-75
TSS cloneGclone-9671318-45

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTTTCTC-96713289671340-55-67
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAATGGGCTTTATTGGGCCCATG-96714049671427-131-154
 AtREG443TAAATGGG                 PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365     GGGCTTTA            PPDB MotifGCCCA  PLACE Motif 
 AtREG601      GGCTTTAT           PPDB Motif  PLACE Motif 
 AtREG417          TTATTGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG355           TATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352            ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392             TTGGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422              TGGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391               GGGCCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG504                GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
REGGTGGGCCTGA-96714299671438-156-165
 AtREG482GTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370 TGGGCCTG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG374  GGGCCTGA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCGTCATTT-96714479671454-174-181
 AtREG657CGTCATTT PPDB Motif  PLACE Motif 
REGAAACGACGC-96714919671499-218-226
 AtREG415AAACGACG  PPDB Motif  PLACE Motif 
 AtREG439 AACGACGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG26+9671517AT3G26420.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+9671513AT3G26420.1
TSS cloneGclone+9671517AT3G26420.1
TSS cloneTclone+9671518AT3G26420.1
TSS cloneTclone+9671522AT3G26420.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCCTCTTCTC+96715449671557AT3G26420.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCATGGGCCCAATAAAGCCCATTTA+96714049671427AT3G26420.1
 AtREG504CATGGGCC                 PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
 AtREG391 ATGGGCCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422  TGGGCCCA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392   GGGCCCAA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355     GCCCAATA            PPDB MotifGCCCA  PLACE Motif 
 AtREG417      CCCAATAA           PPDB MotifGCCCA  PLACE Motif 
 AtREG601          ATAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365           TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376            AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378             AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372              AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386               GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443                CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGTCAGGCCCAC+96714299671438AT3G26420.1
 AtREG374TCAGGCCC   PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370 CAGGCCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482  AGGCCCAC PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGAAATGACG+96714479671454AT3G26420.1
 AtREG657AAATGACG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.