version
PlantPromoterDB promoter information of AT3G26730.1

Summary of Gene (AT3G26730.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G26730  TAIR      NCBI 
Gene model AT3G26730.1  
Description zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 5616 Blast hits to 1874 proteins in 214 species: Archae - 3; Bacteria - 108; Metazoa - 2179; Fungi - 373; Plants - 239; Viruses - 6; Other Eukaryotes - 2708 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 9822770-9823969)

Genome position     
from initiation codon
AT3G26720.1         
AT3G26720.2         
TSS from cDNA
TSS information
AT3G26730.1                      5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G26730.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+9823096-674
TSS peakA2+9823704-66

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+9823685-85
TSS cloneGclone+9823687-83
TSS cloneGclone+9823688-82
TSS cloneAclone+9823714-56

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTTTC+98237459823752-25-18
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAACCGAA+98234179823426-353-344
 AtREG473TTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAACCGGT+98235299823537-241-233
 AtREG496CAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGGGTCGGGT+98236189823628-152-142
 AtREG494CCGGGTCG    PPDB Motif  PLACE Motif 
 AtREG375 CGGGTCGG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442  GGGTCGGG  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405   GGTCGGGT PPDB MotifCCGAC  PLACE MotifCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.