version
PlantPromoterDB promoter information of AT3G27300.3

Summary of Gene (AT3G27300.3)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G27300  TAIR      NCBI 
Gene model AT3G27300.3  
Description glucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 10087288-10086089)

Genome position     
from initiation codon
AT3G27300.1         
AT3G27300.2         
AT3G27310.1         
TSS from cDNA
TSS information
AT3G27300.3                      5'->3' (-)
Promoter sequence


 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G27300.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-10086665-377

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-10086653-365
TSS cloneTclone-10086652-364
TSS cloneAclone-10086638-350

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTAATTA-1008675810086765-470-477
 AtREG646CGTAATTAABA PPDB Motif  PLACE Motif 
REGCTTAATGG-1008677110086778-483-490
 AtREG604CTTAATGG PPDB Motif  PLACE MotifTTAATGG 
REGTTGACTTT-1008685110086858-563-570
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGTTATTGGG-1008688710086894-599-606
 AtREG417TTATTGGG PPDB MotifGCCCA  PLACE Motif 
REGCTAACGGT-1008692010086927-632-639
 AtREG603CTAACGGT PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGTGTTGGGC-1008693710086944-649-656
 AtREG543TGTTGGGC PPDB MotifGCCCA  PLACE MotifCAACA 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.