PlantPromoterDB promoter information of AT3G45160

Summary of Gene (AT3G45160)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G45160 TAIR NCBI
Gene model	AT3G45160
Description	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 16525780-16524581)

`Genome position from initiation codon` `TSS from cDNA TSS information AT3G45160 5'->3' (-) Promoter sequence AT3G45140.1 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G45160

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 17 - 16534079 -149

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	17	-	16534079	-149

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone - 16534082 -152

TSS clone A clone - 16534078 -148

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	-	16534082	-152
TSS clone	`A`	clone	-	16534078	-148

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TGTATAAATA - 16534112 16534121 -182 -191

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TGTATAAATA`	-	16534112	16534121	-182	-191
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CCAATAAG - 16534248 16534255 -318 -325

AtREG611 CCAATAAG PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CCAATAAG`		-	16534248	16534255	-318	-325
	AtREG611	`CCAATAAG`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 8 + 16525412 AT3G45140.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	8	+	16525412	AT3G45140.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone T clone + 16525276 AT3G45140.1

TSS clone G clone + 16525410 AT3G45140.1

TSS clone T clone + 16525411 AT3G45140.1

TSS clone A clone + 16525412 AT3G45140.1

TSS clone A clone + 16525413 AT3G45140.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`T`	clone	+	16525276	AT3G45140.1
TSS clone	`G`	clone	+	16525410	AT3G45140.1
TSS clone	`T`	clone	+	16525411	AT3G45140.1
TSS clone	`A`	clone	+	16525412	AT3G45140.1
TSS clone	`A`	clone	+	16525413	AT3G45140.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box TGTATAAATA + 16525377 16525386 AT3G45140.1

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TGTATAAATA`	+	16525377	16525386	AT3G45140.1
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CCCATATA + 16525243 16525250 AT3G45140.1

AtREG620 CCCATATA PPDB Motif GCCCA PLACE Motif