version
PlantPromoterDB promoter information of AT3G46020.1

Summary of Gene (AT3G46020.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G46020  TAIR      NCBI 
Gene model AT3G46020.1  
Description RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 16914250-16913051)

Genome position     
from initiation codon
AT3G46030.1         
TSS from cDNA
TSS information
AT3G46020.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G46020.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA33-16914131-881
TSS peakG4-16913265-15

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-16914132-882
TSS cloneAclone-16914130-880
TSS cloneTclone-16913795-545

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCATATATATACA-1691415416914166-904-916
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGGCGTCGT-1691332416913336-74-86
 AtREG531AAAACGGC      PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG524 AAACGGCG     PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497  AACGGCGT    PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG540   ACGGCGTC   PPDB Motif  PLACE Motif 
 AtREG537     GGCGTCGT PPDB Motif  PLACE Motif 
REGACGTCGTCGTTTC-1691336016913372-110-122
 AtREG526ACGTCGTC      PPDB MotifACGT  PLACE MotifACGT 
 AtREG648   TCGTCGTT   PPDB Motif  PLACE Motif 
 AtREG415    CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576     GTCGTTTC PPDB Motif  PLACE Motif 
REGTTCCACGTCATC-1691421216914223-962-973
 AtREG627TTCCACGT     PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419  CCACGTCA   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG483   CACGTCAT  PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG578    ACGTCATCABA PPDB MotifACGT  PLACE MotifACGT 
REGCTAACGGT-1691423416914241-984-991
 AtREG603CTAACGGT PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGCTTAATGGCCCATTTA-1691429416914309-1044-1059
 AtREG604CTTAATGG         PPDB Motif  PLACE MotifTTAATGG 
 AtREG437    ATGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490     TGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361      GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG386       GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443        CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGGCCCGTTAAA-1691434216914351-1092-1101
 AtREG399GCCCGTTA   PPDB MotifACGGGC  PLACE MotifYAACKG, CNGTTR 
 AtREG610  CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGTAAGCCCATTT-1691435416914364-1104-1114
 AtREG426TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386   GCCCATTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.