version
PlantPromoterDB promoter information of AT3G46430.1

Summary of Gene (AT3G46430.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G46430  TAIR      NCBI 
Gene model AT3G46430.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59613.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 17086687-17087886)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G46430.1                      5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G46430.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+17087609-78

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+17087597-90
TSS cloneAclone+17087618-69
TSS cloneAclone+17087635-52
TSS cloneAclone+17087642-45

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAAGCCCATTATGGGCTAA+1708750217087522-185-165
 AtREG589AAAAAGCC              PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC             PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357     GCCCATTA         PPDB MotifGCCCA  PLACE Motif 
 AtREG546      CCCATTAT        PPDB Motif  PLACE Motif 
 AtREG394          TTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477           TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581            ATGGGCTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG571             TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTTAGGCC+1708752417087531-163-156
 AtREG430TTTAGGCC PPDB Motif  PLACE Motif 
REGCAAGCCCA+1708753817087545-149-142
 AtREG525CAAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.