version
PlantPromoterDB promoter information of AT3G46560.1

Summary of Gene (AT3G46560.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G46560  TAIR      NCBI 
Gene model AT3G46560.1  
Description Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.  
#
#

Overview

Focused view (chromosome 3: 17137632-17138831)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G46560.1                      5'->3' (+)
Promoter sequence










 
AT3G46550.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G46560.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG18+17138597-35

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+17138594-38
TSS cloneTclone+17138600-32
TSS cloneGclone+17138603-29
TSS cloneGclone+17138624-8

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCTAAT+1713847617138484-156-148
 AtREG360GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG506 GGCCTAAT PPDB Motif  PLACE Motif 
REGGGCTTTAA+1713849817138505-134-127
 AtREG545GGCTTTAA PPDB Motif  PLACE Motif 
REGATAAAGCCCACCAGGCCCAATAA+1713851917138541-113-91
 AtREG601ATAAAGCC                PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC               PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518   AAGCCCAC             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG619          CCAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370           CAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356            AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352             GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355              GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417               CCCAATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-17137900AT3G46550.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTCTT-1713790517137914AT3G46550.1
Y PatchCTTCCTTCTCT-1713791817137928AT3G46550.1
Y PatchCATCTCTC-1713793917137946AT3G46550.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGCGTGAA-1713803817138045AT3G46550.1
 AtREG631CGCGTGAADrought PPDB Motif  PLACE Motif 
REGCCCACGTGGG-1713817417138183AT3G46550.1
 AtREG464CCCACGTGGGABA, Auxin, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.