version
PlantPromoterDB promoter information of AT3G48140

Summary of Gene (AT3G48140)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G48140  TAIR      NCBI 
Gene model AT3G48140  
Description senescence-associated protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: leaf senescence; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: B12D (InterPro:IPR010530); BEST Arabidopsis thaliana protein match is: germination protein-related (TAIR:AT3G29970.1); Has 78 Blast hits to 78 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 17789171-17790370)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G48140                        5'->3' (+)
Promoter sequence

 
AT3G48170.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G48140

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10+17778401-70

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+17778391-80
TSS cloneTclone+17778395-76
TSS cloneTclone+17778397-74
TSS cloneAclone+17778400-71
TSS cloneAclone+17778401-70
TSS cloneCclone+17778402-69
TSS cloneTclone+17778404-67
TSS cloneTclone+17778405-66
TSS cloneTclone+17778407-64
TSS cloneAclone+17778409-62
TSS cloneTclone+17778419-52
TSS cloneTclone+17778454-17

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTAAATATAAAG+1777836617778376-105-95
Y PatchCGTCTTCTTCCTCCTTC+1777841717778433-54-38
Y PatchTCTCTCTC+1777843617778443-35-28
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTATATGGG+1777813117778138-340-333
 AtREG620TATATGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA10-17790008AT3G48170.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-17790007AT3G48170.1
TSS cloneAclone-17789974AT3G48170.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAACCGGTTTAG-1779022117790233AT3G48170.1
 AtREG542AAAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412    CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511     CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.