PlantPromoterDB promoter information of AT3G48140

Summary of Gene (AT3G48140)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G48140 TAIR NCBI
Gene model	AT3G48140
Description	senescence-associated protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: leaf senescence; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: B12D (InterPro:IPR010530); BEST Arabidopsis thaliana protein match is: germination protein-related (TAIR:AT3G29970.1); Has 78 Blast hits to 78 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 17793521-17794720)

`Genome position from initiation codon` `TSS from cDNA TSS information AT3G48140 5'->3' (+) Promoter sequence AT3G48185.1 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G48140

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 10 + 17778401 -70

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	10	+	17778401	-70

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone C clone + 17778391 -80

TSS clone T clone + 17778395 -76

TSS clone T clone + 17778397 -74

TSS clone A clone + 17778400 -71

TSS clone A clone + 17778401 -70

TSS clone C clone + 17778402 -69

TSS clone T clone + 17778404 -67

TSS clone T clone + 17778405 -66

TSS clone T clone + 17778407 -64

TSS clone A clone + 17778409 -62

TSS clone T clone + 17778419 -52

TSS clone T clone + 17778454 -17

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`C`	clone	+	17778391	-80
TSS clone	`T`	clone	+	17778395	-76
TSS clone	`T`	clone	+	17778397	-74
TSS clone	`A`	clone	+	17778400	-71
TSS clone	`A`	clone	+	17778401	-70
TSS clone	`C`	clone	+	17778402	-69
TSS clone	`T`	clone	+	17778404	-67
TSS clone	`T`	clone	+	17778405	-66
TSS clone	`T`	clone	+	17778407	-64
TSS clone	`A`	clone	+	17778409	-62
TSS clone	`T`	clone	+	17778419	-52
TSS clone	`T`	clone	+	17778454	-17

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TAAATATAAAG + 17778366 17778376 -105 -95

Y Patch CGTCTTCTTCCTCCTTC + 17778417 17778433 -54 -38

Y Patch TCTCTCTC + 17778436 17778443 -35 -28

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TAAATATAAAG`	+	17778366	17778376	-105	-95
Y Patch	`CGTCTTCTTCCTCCTTC`	+	17778417	17778433	-54	-38
Y Patch	`TCTCTCTC`	+	17778436	17778443	-35	-28
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TATATGGG + 17778131 17778138 -340 -333

AtREG620 TATATGGG PPDB Motif GCCCA PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TATATGGG`		+	17778131	17778138	-340	-333
	AtREG620	`TATATGGG`		PPDB Motif	`GCCCA`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 4 - 17793687 AT3G48185.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	4	-	17793687	AT3G48185.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TTTCCTCC - 17793648 17793655 AT3G48185.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TTTCCTCC`	-	17793648	17793655	AT3G48185.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG TTACCCCT - 17793807 17793814 AT3G48185.1

AtREG642 TTACCCCT PPDB Motif ACCCCT PLACE Motif