PlantPromoterDB promoter information of AT3G49010
Summary of Gene (AT3G49010)
|
Overview
|
Focused view (chromosome 3: 18169047-18167848)
|
Genome position
from initiation codon AT3G49010.2 AT3G49010.3 AT3G49010.4 AT3G49010.5 TSS from cDNA TSS information AT3G49010 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G49010
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 87 | - | 18168688 | -641 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | - | 18168689 | -642 |
| TSS clone | A | clone | - | 18168688 | -641 |
| TSS clone | T | clone | - | 18168687 | -640 |
| TSS clone | A | clone | - | 18168686 | -639 |
| TSS clone | C | clone | - | 18168685 | -638 |
| TSS clone | A | clone | - | 18168681 | -634 |
| TSS clone | G | clone | - | 18168680 | -633 |
| TSS clone | T | clone | - | 18168677 | -630 |
| TSS clone | A | clone | - | 18168645 | -598 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TTCTCTCT | - | 18168649 | 18168656 | -602 | -609 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TTCGGCCCACCGGCCCAATAA | - | 18168750 | 18168770 | -703 | -723 | |||
| AtREG427 | TTCGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG393 | TCGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG457 | CCGGCCCA | CK | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | |||
| AtREG414 | CGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG352 | GGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG355 | GCCCAATA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG417 | CCCAATAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | CAAGCCCAAA | - | 18168794 | 18168803 | -747 | -756 | |||
| AtREG525 | CAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG407 | AAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG469 | AGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||