version
PlantPromoterDB promoter information of AT3G49560.1

Summary of Gene (AT3G49560.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G49560  TAIR      NCBI 
Gene model AT3G49560.1  
Description mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT5G24650.1); Has 56 Blast hits to 54 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 18369644-18370843)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G49560.1                      5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G49560.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13+18370570-74

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+18370577-67

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCATATATAAC+1837053018370540-114-104
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAATGGGCTTTTTTCAGGCCCAG+1837050218370525-142-119
 AtREG443TAAATGGG                 PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409     GGGCTTTT            PPDB MotifGCCCA  PLACE Motif 
 AtREG589      GGCTTTTT           PPDB Motif  PLACE Motif 
 AtREG374              TCAGGCCC   PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370               CAGGCCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410                AGGCCCAG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.