PlantPromoterDB promoter information of AT3G49780

Summary of Gene (AT3G49780)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G49780 TAIR NCBI
Gene model	AT3G49780
Description	Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype.

#

Overview

Focused view (chromosome 3: 18468600-18469799)

`Genome position from initiation codon` `TSS from cDNA TSS information AT3G49780 5'->3' (+) Promoter sequence AT3G49790.1 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G49780

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 20 + 18465679 -71

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	20	+	18465679	-71

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 18465679 -71

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	18465679	-71

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CACTATAAATT + 18465642 18465652 -108 -98

Y Patch TCTCTCTTCTC + 18465703 18465713 -47 -37

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CACTATAAATT`	+	18465642	18465652	-108	-98
Y Patch	`TCTCTCTTCTC`	+	18465703	18465713	-47	-37
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG GGGCCGTA + 18465432 18465439 -318 -311

AtREG499 GGGCCGTA PPDB Motif GCCCA PLACE Motif GGGCC

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`GGGCCGTA`		+	18465432	18465439	-318	-311
	AtREG499	`GGGCCGTA`		PPDB Motif	`GCCCA`	PLACE Motif	`GGGCC`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 5 - 18469684 AT3G49790.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	5	-	18469684	AT3G49790.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone A clone - 18469763 AT3G49790.1

TSS clone A clone - 18469673 AT3G49790.1

TSS clone C clone - 18469636 AT3G49790.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`A`	clone	-	18469763	AT3G49790.1
TSS clone	`A`	clone	-	18469673	AT3G49790.1
TSS clone	`C`	clone	-	18469636	AT3G49790.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTCTCTCTCTT - 18469720 18469731 AT3G49790.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTCTCTCTCTT`	-	18469720	18469731	AT3G49790.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CCCAATAA - 18469739 18469746 AT3G49790.1

AtREG417 CCCAATAA PPDB Motif GCCCA PLACE Motif