PlantPromoterDB promoter information of AT3G50950

Summary of Gene (AT3G50950)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G50950 TAIR NCBI
Gene model	AT3G50950
Description	disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182); BEST Arabidopsis thaliana protein match is: RPP8 (RECOGNITION OF PERONOSPORA PARASITICA 8); nucleotide binding (TAIR:AT5G43470.2); Has 10683 Blast hits to 9585 proteins in 351 species: Archae - 2; Bacteria - 172; Metazoa - 185; Fungi - 106; Plants - 10108; Viruses - 8; Other Eukaryotes - 102 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 18935127-18936326)

`Genome position from initiation codon` `AT3G50940.1 AT3G50950.1 AT3G50950.2 TSS from cDNA TSS information AT3G50950 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G50950

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 4 + 18935713 -414

TSS peak G 13 + 18935825 -302

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	4	+	18935713	-414
TSS peak	`G`	13	+	18935825	-302

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 18935681 -446

TSS clone A clone + 18935743 -384

TSS clone A clone + 18935814 -313

TSS clone A clone + 18935818 -309

TSS clone G clone + 18935820 -307

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	18935681	-446
TSS clone	`A`	clone	+	18935743	-384
TSS clone	`A`	clone	+	18935814	-313
TSS clone	`A`	clone	+	18935818	-309
TSS clone	`G`	clone	+	18935820	-307

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCCTTCTC + 18935857 18935864 -270 -263

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCCTTCTC`	+	18935857	18935864	-270	-263
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TAAAAGCC + 18935491 18935498 -636 -629

AtREG549 TAAAAGCC PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TAAAAGCC`		+	18935491	18935498	-636	-629
	AtREG549	`TAAAAGCC`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None