PlantPromoterDB promoter information of AT3G51800.1
Summary of Gene (AT3G51800.1)
|
Overview
|
Focused view (chromosome 3: 19214568-19213369)
|
Genome position
from initiation codon TSS from cDNA TSS information AT3G51800.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G51800.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 13 | - | 19213633 | -65 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 19213669 | -101 |
| TSS clone | C | clone | - | 19213668 | -100 |
| TSS clone | C | clone | - | 19213649 | -81 |
| TSS clone | C | clone | - | 19213646 | -78 |
| TSS clone | G | clone | - | 19213643 | -75 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTCCTCCT | - | 19213621 | 19213628 | -53 | -60 |
| Y Patch | TTTCTCTCCTTCTC | - | 19213649 | 19213662 | -81 | -94 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AAAACGGCA | - | 19213727 | 19213735 | -159 | -167 | |||
| AtREG531 | AAAACGGC | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| AtREG500 | AAACGGCA | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| REG | TTCGGCCCATA | - | 19213786 | 19213796 | -218 | -228 | |||
| AtREG427 | TTCGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG393 | TCGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG380 | CGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG364 | GGCCCATA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| REG | TGACGTGGGCTTATATGGGCCCGGTTAAGGGTA | - | 19213835 | 19213867 | -267 | -299 | |||
| AtREG419 | TGACGTGG | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG, TGACGTGG, CCACGTCA | ||||
| AtREG518 | GTGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG426 | TGGGCTTA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG462 | GGGCTTAT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG620 | TATATGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG432 | ATATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG364 | TATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG391 | ATGGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG501 | CCGGTTAA | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| AtREG605 | CGGTTAAG | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| AtREG570 | TAAGGGTA | PPDB Motif | ACCCT | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||